View Article

  • Anti-inflammatory Effects of a Curcumin-Thymoquinone Complex (CurQnone®) and Curcumin Alone in LPS-Stimulated RAW 264.7 Cells: A Comparative Study

  • 1Bio-gen Extracts Pvt. Ltd., Bangalore, India.
    2R&D Head, Radiant Research Bangalore, India.
    3Director, Radiant Research, Bangalore, India.
    4Consultant Pharmacologist, Bangalore, India.
     

Abstract

Background: Curcumin, a major constituent of turmeric, is widely recognized for its anti-inflammatory and immunomodulatory properties. Thymoquinone (TQ), a bioactive phytochemical derived from Nigella sativa, has been shown to inhibit inflammatory mediators such as IL-6, IL-2, and PGE2 in human immune and epithelial cells. Given their individual efficacy, combining curcumin and TQ may enhance anti-inflammatory effects while potentially reducing the required dose of curcumin. Methods: The anti-inflammatory activity of a Curcumin-Thymoquinone (CTQ) complex (CurQnone®) was evaluated and compared with curcumin alone in LPS-stimulated RAW 264.7 macrophage cells. Cytotoxicity was assessed using the MTT assay to identify non-toxic concentrations. Subsequently, cells were treated with CTQ or curcumin at 15.62 and 7.8 µg/mL in the presence of LPS (1 µg/mL) to induce an anti-inflammatory response. The mRNA expression levels of TNF-?, COX-2, and iNOS were measured using semi-quantitative RT-PCR. Results: Both CTQ and curcumin significantly downregulated the mRNA expression of TNF-?, COX-2, and iNOS in LPS-stimulated cells. Notably, CTQ exhibited better efficacy (TNF a by ~7% & COX-2 by ~16%) in suppressing these inflammatory gene markers compared to curcumin alone at equivalent concentrations. Conclusion: CTQ demonstrated enhanced anti-inflammatory activity relative to curcumin, suggesting its potential as a more effective therapeutic intervention for inflammatory conditions. These findings support further investigation into CTQ’s use as an immunomodulatory agent.

Keywords

CurQnone®, curcumin, thymoquinone, inflammation, RAW 264.7, TNF-?, COX-2, iNOS, RT-PCR

Introduction

× Popup Image

Inflammation is a natural biological defence mechanism triggered in response to infection, injury, or harmful stimuli mediated by a complex network of immune cells that includes macrophages, neutrophils, and lymphocytes. Inflammatory responses can be initiated by biological, chemical, or physical agents, leading to the release of various mediators such as eicosanoids, reactive oxygen species, cytokines, chemokines, and lytic enzymes (Farkhondeh et al., 2015; Turner et al., 2014). Among the key enzymes involved, cyclooxygenase (COX) and lipoxygenase (LOX) contribute to the biosynthesis of pro-inflammatory molecules. Nitric oxide (NO), produced by inducible nitric oxide synthase (iNOS), further amplifies tissue inflammation via oxidative stress (Yazdi et al., 2018). Curcumin, a polyphenolic compound derived from the rhizome of Curcuma longa (turmeric), exhibits well-documented anti-inflammatory, antioxidant, and anti-tumor properties. Curcumin has demonstrated impressive inhibitory capabilities against critical inflammatory mediators, including NF-kB, COX-2, LOX enzyme, and inducible iNOS (Bengmark, 2006) Thymoquinone (TQ), the principal active constituent of Nigella sativa (black seed) oil, has demonstrated potent immunomodulatory and anti-inflammatory effects. TQ (ThymoPure™) has been shown to suppress the expression of cytokines such as TNF-α, IL-1β, IL-6, and IL-17, as well as inhibit dendritic cell maturation and promote apoptosis of activated immune cells.  Studies have also revealed that TQ enhances phagocytic activity in mouse macrophages, suggesting a potential to strengthen innate immune responses. These effects make TQ a promising candidate for modulating inflammatory diseases (Mehkri et al., 2021a). TQ decreased the secretion of NO and PGE2 and downregulated inflammatory gene expression in activated macrophages. TQ also inhibited the expression of multiple genes involved in these processes including IL-6, TNF-α, iNOS, and COX-2 in LPS-, pam3CSK-, and poly (I:C)-stimulated macrophage-like RAW264.7 cells (Hossen, M, et al 2017; Mehkri et al., 2021b,c).  Previous studies on TQ and Nigella sativa oil have primarily focused on mediators such as IL-2, IL-6, and PGE2, which are critical in respiratory inflammation. However, key mediators like TNF-α, COX-2, and iNOS are central to a broader range of acute and chronic inflammatory conditions, including sepsis, trauma, and autoimmune disorders. Their upregulation is often associated with disease progression and offers an important therapeutic target. NF-κB, MAPK, and STAT3 are key signalling pathways involved in various cellular processes, including inflammation, immune responses, and cancer development. They act as intracellular messengers, relaying external signals to regulate gene expression and cellular behaviour.  It regulates elements of cellular regulators such as cytokines, growth factors, adhesion molecules, intracellular signalling molecules, transcription factors as well as miRNAs which enable synthesis of proteins, their functions and their degradation This study investigates the potential of a curcumin-thymoquinone (CTQ) complex (CurQnone®), a proprietary combination of curcumin and thymoquinone, in modulating the inflammatory response compared to curcumin alone. Using an in vitro LPS-induced RAW 264.7 macrophage model, we evaluated the mRNA expression of TNF-α, COX-2, and iNOS to assess the comparative efficacy of these interventions in attenuating inflammation.

MATERIALS AND METHODS

Preparation of Test Solution

CurQnone®, a curcumin-thymoquinone (CTQ) complex, and curcumin were each weighed (10 mg) and separately dissolved in DMEM-HG (Dulbecco’s modified eagle’s medium—high glucose) supplemented with 2% heat-inactivated fetal bovine serum (FBS). The volume was adjusted with media to obtain a stock solution of 1 mg/mL, which was sterilized by filtration. Serial two-fold dilutions were prepared from the stock solution for cytotoxicity and efficacy studies. Non-toxic concentrations of the test substances were selected for evaluating their effects on cytokine expression in mouse macrophage cells.

Cell Line and Culture Medium

RAW 264.7 (mouse macrophage) cells were obtained from the National Centre for Cell Sciences (NCCS), Pune, India. Cells were cultured in DMEM supplemented with 10% heat-inactivated FBS, penicillin (100 IU/mL), streptomycin (100 µg/mL), and amphotericin B (5 µg/mL) in a humidified atmosphere of 5% CO? at 37°C until confluent. Cells were dissociated using trypsin phosphate versene glucose (TPVG) solution (0.2% trypsin, 0.02% EDTA, 0.05% glucose in PBS). Stock cultures were maintained in 25 cm² culture flasks, and all experiments were performed in 96-well microtiter plates (Tarsons India Pvt. Ltd., Kolkata, India).

Cytotoxicity Studies

Cell viability in response to CurQnone® and curcumin was assessed using the MTT reduction assay as described by Denizot and Lang (1986). Semi-confluent monolayer cultures were treated with drug solutions and incubated at 37°C in a 5% CO? atmosphere for 72 hours. After incubation, plates were centrifuged at 500 × g, and the drug-containing media were removed. One hundred microliters of MTT solution in PBS was added to each well, and plates were incubated for 3 hours at 37°C under 5% CO?. Following incubation, the supernatant was removed, and 100 µL of DMSO was added to solubilize the formazan crystals. Absorbance was measured at 540 nm using a microplate reader. Plates were protected from light throughout the procedure. Percentage growth inhibition was calculated relative to untreated controls, and the concentration causing 50% inhibition of cell growth (CTC??) was determined from dose-response curves.

Treatment for Gene Expression

RAW 264.7 cells (1.5 × 10?) were seeded into 60 mm petri dishes and cultured in DMEM until 70–80% confluency was reached. Cells were then treated with non-toxic concentrations of the test substances, along with lipopolysaccharide (LPS) at 1 µg/mL. After 24 hours of incubation at 37°C, cells were harvested for gene expression analysis.

RNA Isolation and cDNA Synthesis

Treated cells were lysed using tri-extract reagent, followed by chloroform addition and centrifugation to isolate total RNA. The aqueous phase was collected, mixed with an equal volume of isopropanol, and incubated at –20°C for 10 minutes. After centrifugation, the RNA pellet was washed with ethanol, air-dried, and resuspended in TAE buffer. cDNA synthesis was performed using oligo dT primers and reverse transcriptase enzyme following the manufacturer’s protocol (Thermo Scientific).

RT-PCR Procedure

mRNA expression levels of TNF-α, iNOS, and COX-2 were evaluated using semi-quantitative reverse transcriptase polymerase chain reaction (RT-PCR). PCR reactions (50 µL) included cDNA templates and gene-specific primers (Eurofins, India). GAPDH was used as an internal housekeeping control. Amplification conditions were as follows: initial denaturation at 95°C for 5 minutes, followed by 35 cycles of 95°C for 30 seconds, annealing at the gene-specific melting temperature (Tm) for 30 seconds, and extension at 72°C for 45 seconds, with a final extension at 72°C for 10 minutes.

Table 1. Primer sequences used for semi-quantitative RT-PCR

Gene

Primer Direction

Sequence (5′→3′)

TNF-α

Forward (F)

TGAGCCCATATACCTGGGAGG

 

Reverse (R)

CGGACTCCGCAAAGTCTAAG

COX-2

Forward (F)

GGAGAGACTATCAAGATAGT

 

Reverse (R)

ATGGTCAGTAGACTTTTACA

iNOS

Forward (F)

AGGTACTCAGCGTGCTCCAC

 

Reverse (R)

TGGCCACCAGCTTCTTCAATG

RESULTS

Cytotoxicity Study

Table 2. In vitro cytotoxicity of CTQ and curcumin, expressed as percentage cell viability and cytotoxicity in RAW 264.7 cells using the MTT assay

Sl. No

Name of Test substance

Test Conc.

(μg/ml)

%

Cytotoxicity

%

Cell viability

 

 

 

1.

 

 

 

Curcumin

 

1000

500

250

125

62.5

31.25

15.62

7.8

39.57 ± 2.50

26.29 ± 0.95

21.38 ± 0.52

18.71 ± 1.12

9.74 ± 2.33

4.66 ± 1.55

2.35 ± 1.12

0.67 ± 0.39

60.5 ± 2.50

73.71 ± 0.95

78.62 ± 0.52

81.29 ± 1.12

90.26 ± 2.33

95.34 ± 1.55

97.65 ± 1.12

99.33 ± 0.39

 

 

 

2.

 

 

 

CTQ

 

1000

500

250

125

62.5

31.25

15.62

7.8

49.40 ± 0.09

40.69 ± 1.03

26.03 ± 1.03

18.62 ± 0.86

15.34 ± 0.69

12.93 ± 3.79

9.75 ± 2.31

5.2 ± 1.35

50.6 ± 0.09

59.31 ± 1.03

73.97 ± 1.03

81.38 ± 0.86

84.66 ± 0.69

87.07 ± 3.79

90.25 ± 2.31

94.8 ± 1.35

Mouse macrophages (RAW 264.7 cells) were exposed to various concentrations of CTQ and curcumin, as presented in Table 2. Both test substances exhibited higher cell viability at lower concentrations. The concentrations of 15.62 µg/mL and 7.8 µg/mL were identified as non-toxic, showing significantly better cell viability compared to higher concentrations. These doses were selected for subsequent gene expression studies.

Table 3: Quantitative gene expression levels of TNF-α, COX-2, and iNOS normalized to GAPDH.

Test Sample

Concentration

(µg/mL)

TNF-a

COX-2

Nitric oxide synthase

Cell control

-

1.00

1.00

1.00

LPS control

1

1.27

1.61

1.18

Curcumin

15.62

1.21

1.55

1.08

7.8

1.24

1.57

1.15

CTQ

15.62

1.13

1.22

1.08

7.8

1.16

1.30

1.15

Gene expression Analysis

Reverse transcriptase-PCR (RT-PCR) was performed on mouse macrophage cells using specific primers for TNF-α, inducible nitric oxide synthase (iNOS), and COX-2. Semi-quantitative RT-PCR analysis showed that TNF-α expression was upregulated by 1.27-fold in LPS-treated cells compared to the untreated control. Treatment with curcumin at concentrations of 7.8 μg/mL and 15.62 μg/mL reduced TNF-α expression to 1.24-fold and 1.21-fold, respectively. In contrast, CTQ treatment resulted in a more pronounced reduction to 1.16-fold and 1.13-fold, respectively, compared to the LPS control. iNOS expression was similarly upregulated by 1.18-fold in LPS-treated cells relative to the untreated control. Curcumin treatment at 7.8 μg/mL and 15.62 μg/mL decreased iNOS expression to 1.15-fold and 1.12-fold, respectively, while CTQ treatment further reduced expression to 1.10-fold and 1.08-fold, indicating a stronger inhibitory effect. COX-2 expression was elevated by 1.61-fold in response to LPS stimulation. Treatment with curcumin reduced COX-2 expression to 1.57-fold and 1.55-fold at 7.8 μg/mL and 15.62 μg/mL, respectively. CTQ produced a greater downregulation, with expression levels reduced to 1.30-fold and 1.22-fold at corresponding concentrations. These RT-PCR results indicate that both CTQ and curcumin exhibit anti-inflammatory activity by downregulating the LPS-induced expression of TNF-α, iNOS, and COX-2 in mouse macrophages, with CTQ demonstrating greater efficacy across all three markers.

Figure 1. Densitometric analysis of TNF-α gene expression normalized to GAPDH

Figure1 presents the relative TNF-α gene expression levels in mouse macrophages, normalized to GAPDH, for the following groups: untreated control (cell control), LPS-treated control, and treatment groups (CTQ, and curcumin alone). Both CTQ and curcumin significantly reduced TNF-α expression compared to the LPS-treated control, indicating their potential anti-inflammatory effects. Figure 2 illustrates the relative COX-2 gene expression levels in mouse macrophages, normalized to GAPDH, across different groups: untreated control (cell control), LPS-treated control, and treatment groups (CTQ, and curcumin alone). A noticeable reduction in COX-2 expression was observed in both treatment groups compared to the LPS-treated control, indicating their potential to suppress inflammation induced COX-2 upregulation.

Figure 3. Densitometric analysis of nitric oxide synthase (iNOS) gene expression normalized to GAPDH.

Figure 3 presents the relative expression levels of the iNOS gene in mouse macrophages, normalized to GAPDH, across different experimental groups: untreated control (cell control), LPS-treated control, and treatment groups (CTQ, and curcumin alone). Both treatment groups showed a reduction in iNOS gene expression compared to the LPS-treated control, indicating their inhibitory effect on inflammation-induced nitric oxide synthase upregulation.

DISCUSSION

Inflammation is a complex biological response orchestrated by the immune system in reaction to pathogens, cellular damage, or irritants. Central to this response is a network of cytokines and signalling molecules that mediate and regulate immune and inflammatory processes. Among these, tumour necrosis factor-alpha (TNF-α), cyclooxygenase-2 (COX-2), and inducible nitric oxide synthase (iNOS) are key mediators involved in the propagation of chronic inflammation. Dysregulated or sustained overexpression of these cytokines has been implicated in the pathophysiology of several chronic diseases, including autoimmune, metabolic, and respiratory disorders (Soliman et al., 2009). The present study evaluated the anti-inflammatory potential of a curcumin-thymoquinone (CTQ) complex (CurQnone®), compared to curcumin alone, by examining their effects on the mRNA expression of TNF-α, COX-2, and iNOS in LPS-stimulated RAW 264.7 mouse macrophage cells using semi-quantitative RT-PCR. Cytotoxicity studies were first conducted to determine the non-toxic concentrations for subsequent gene expression analysis. Both CTQ and curcumin showed no cytotoxic effects at concentrations of 7.82 µg/mL and 15.62 µg/mL, which were selected for further evaluation. Quantitative RT-PCR analysis revealed a dose-dependent reduction in the mRNA expression levels of TNF-α, COX-2, and iNOS with both CTQ and curcumin. However, CTQ consistently exhibited a greater degree of suppression compared to curcumin alone. Specifically, TNF-α expression decreased significantly at both low and high doses of CTQ, indicating its potent anti-inflammatory effect. These findings align with previous studies where Nigella sativa (the source of thymoquinone) inhibited inflammatory cytokines such as TNF-α and IL-1β, while enhancing anti-inflammatory mediators like IL-8 in PBMCs by modulating chemokine and adhesion molecule expression (Salem, 2005; Mehkri et al., 2021). Studies have supported findings that LPS is one of the major inducers of TNF-α in macrophages and monocytes and that curcumin can down-regulate the expression of TNF-α. Numerous reports have suggested that the production of TNF from macrophages activated by various stimuli can be suppressed by curcumin. TNF is also expressed by microglial cells, adipocytes and other cell types. Curcumin, however, has been shown to down-regulate TNF expression. TQ has been shown to suppress COX2 expression and the ensuing generation of prostaglandins . Another study has shown that TQ possesses anti-inflammatory and anti-oxidative efficacy by suppressing 12-O-tetradecanoylphorbol-13-acetate (TPA)-stimulated COX-2 expression and NF-κB activation, as well as enhancing the cytoprotective protein expression in nude mouse skin. COX-2 expression also declined significantly in response to CTQ, with the higher dose (15.62 µg/mL) leading to a more pronounced suppression than the lower dose (7.82 µg/mL).  Furthermore, CTQ reduced iNOS expression more effectively than curcumin. Mehkri et al. (2021) previously demonstrated that ThymoPure™, a Nigella sativa oil formulation, reduced iNOS expression in RAW 264.7 cells, with a 0.91-fold decrease at 125 µg/mL and a 0.99-fold decrease at 62.5 µg/mL compared to untreated control. These results support the contribution of TQ in downregulating nitric oxide-mediated inflammatory signalling. Curcumin, at low concentrations (0.5–2 μM) inhibits LPS-stimulated NO production and iNOS expression in RAW 264.7 cells. Curcumin inhibits iNOS expression and NO production at least in part via direct interference with activation of NF-κB.  The protein level of iNOS in peritoneal macrophages was also decreased by TQ in a concentration-dependent manner. In addition, TQ inhibited the increase in iNOS mRNA expression induced by LPS indicated by reverse transcription-polymerase chain reaction (RT-PCR). These inhibitory effects of TQ were confirmed by immunofluorescence staining of iNOS in macrophages which showed decreased immunoreactivity for iNOS after treatment with TQ if compared with the control LPS-stimulated cells. The combined effect of curcumin and thymoquinone likely results from their synergistic modulation of multiple inflammatory signaling pathways, such as NF-κB, MAPK, and STAT3, which are known to regulate TNF-α, COX-2, and iNOS gene expression. Curcumin has been well documented to inhibit NF-κB activation, while thymoquinone has demonstrated complementary effects on both NF-κB and MAPKs. Together, they may exert a broader and more effective anti-inflammatory response than either compound alone. This suggests a dose-responsive inhibitory effect on prostaglandin biosynthesis, a key mechanism in chronic inflammation which may be the possible mechanism of action of CTQ. Although these results offer strong in vitro evidence supporting the synergistic anti-inflammatory action of CTQ, further in vivo validation and clinical trials are needed to establish its efficacy and safety in human populations. Such studies will help clarify the precise mechanisms through which CTQ modulates inflammatory cascades and its potential role in managing chronic inflammatory disorders.

CONCLUSION

A curcumin-thymoquinone (CTQ) complex (CurQnone®) demonstrated superior anti-inflammatory effects compared to curcumin alone, in LPS-stimulated RAW 264.7 macrophages. It effectively downregulated key pro-inflammatory markers including TNF-α, COX-2, and iNOS. These findings support CTQ as a promising candidate for further development as a therapeutic agent for inflammatory diseases.

REFERENCES

  1. Denizot, F., & Lang, R. (1986). Rapid colorimetric assay for cell growth and survival: modifications to the tetrazolium dye procedure giving improved sensitivity and reliability. Journal of immunological methods, 89(2), 271-277.
  2. Farkhondeh, T.; Samarghandian, S.; Azimin-Nezhad, M.; Samini, F. Effect of chrysin on nociception in formalin test and serum levels of noradrenalin and corticosterone in rats. Int. J. Clin. Exp. Med., 2015, 8(2), 2465-2470.
  3. Bengmark S. Curcumin, an atoxic antioxidant and natural NFkappaB, cyclooxygenase-2, lipooxygenase, and inducible nitric oxide synthase inhibitor: A shield against acute and chronic diseases. J. Parenter. Enteral. Nutr. 2006;30:45–51.
  4. Lee, S. B., Lee, W. S., Shin, J. S., Jang, D. S., & Lee, K. T. (2017). Xanthotoxin suppresses LPS-induced expression of iNOS, COX-2, TNF-α, and IL-6 via AP-1, NF-κB, and JAK-STAT inactivation in RAW 264.7 macrophages. International immunopharmacology, 49, 21-29.
  5. Hossen, M., Yang, W., Kim, D. et al. Thymoquinone: An IRAK1 inhibitor with in vivo and in vitro anti-inflammatory activities. Sci Rep 7, 42995 (2017).
  6. Meng, Z., Yan, C., Deng, Q., Gao, D. F., & Niu, X. L. (2013). Curcumin inhibits LPS-induced inflammation in rat vascular smooth muscle cells in vitro via ROS-relative TLR4-MAPK/NF-κB pathways. Acta Pharmacologica Sinica, 34(7), 901-911.
  7. Setyono, J., Harini, I. M., Sarmoko, S., & Rujito, L. (2019). Supplementation of curcuma domestica extract reduces cox-2 and iNOS expression on raw 264.7 cells. In Journal of Physics: Conference Series (Vol. 1246, No. 1, p. 012059). IOP Publishing.
  8. Shaterzadeh-Yazdi, H., Noorbakhsh, M. F., Hayati, F., Samarghandian, S., & Farkhondeh, T. (2018). Immunomodulatory and anti-inflammatory effects of thymoquinone. Cardiovascular & Haematological Disorders-Drug Targets (Formerly Current Drug Targets-Cardiovascular & Hematological Disorders), 18(1), 52-60.
  9. Turner, M.D.; Nedjai, B.; Hurst, T.; Pennington, D.J. Cytokines and chemokines: At the crossroads of cell signaling and inflammatory disease. Biochim. Biophys. Acta., 2014, 30, 1843(11), 2563-2582.
  10. Wang, D., Qiao, J., Zhao, X., Chen, T., & Guan, D. (2015). Thymoquinone inhibits IL-1β-induced inflammation in human osteoarthritis chondrocytes by suppressing NF-κB and MAPKs signaling pathway. Inflammation, 38, 2235-2241.
  11. Yard?mc?, M., Goz, M., Ayd?n, M. S., Kank?l?ç, N., & Temiz, E. (2022). Antioxidant actions of thymoquinone, silymarin, and curcumin on experimental aortic ischemia-reperfusion model in wistar albino rats. Brazilian Journal of Cardiovascular Surgery, 37(06), 807-813.
  12. Zhang, Y., Liang, D., Dong, L., Ge, X., Xu, F., Chen, W., ... & Liang, G. (2015). Anti-inflammatory effects of novel curcumin analogs in experimental acute lung injury. Respiratory research, 16, 1-13.
  13. Peng Y, Ao M, Dong B, Jiang Y, Yu L, Chen Z, Hu C, Xu R. Anti-Inflammatory Effects of Curcumin in the Inflammatory Diseases: Status, Limitations and Countermeasures. Drug Des Devel Ther. 2021 Nov 2;15:4503-25.
  14. Mehkri S., Chandrasagar K., Ashok G., Bopanna K. "Evaluation of in vitro immuno modulatory activity of thymopure™ Nigella sativa oil in dendritic cells ". International Journal of Biology Research, Volume 6, Issue 2, 2021a, Pages 53-57
  15. Mehkri S., Chandrasagar K., Ashok G., Bopanna K. "Evaluation of in vitro phagocytic property of macrophages in presence of thymopure™ (Nigella Sativa) oil " . International Journal of Biology Research, Volume 6, Issue 2, 2021b, Pages 18-21
  16. Mehkri S., Chandrasagar K., Ashok G., Bopanna K. "Evaluation of thymopureTM (Nigella sativa) oil on the in vitro expression levels of selected cytokines in mouse macrophages cells" . International Journal of Biology Research, Volume 6, Issue 4, 2021c, Pages 5-10
  17. M.M. Soliman, Y.A. El-Fattah El-Senosi, O.M.A. El-Hamid, A.El-Desouki Abd El-Mageed, R.S. Ismaeil and H.A. El-Maqsoud Ali, 2009. Nigella sativa Modulates Cytokines Expression in Mature Bovine Adipocytes. Asian Journal of Biochemistry, 4: 60-67.
  18. Ibrahim, S., M. Ishizuka, M. Soliman, K. El-Bohi and K. Sobhy et al., 2008. Protection by Nigella sativa against carbon tetrachloride induced downregulation of hepatic cytochrome P450 isozymes in rats. Japanese J. Vet. Res., 56: 119-128.
  19. Salem, M.L., 2005. Immunomodulatory and therapeutic properties of the Nigella sativa L. seed. Int. Immunopharmacol., 5: 1749-1770.
  20. Howard, M., T. Muchamuel, S. Andrade and S. Menon, 1993. Interleukin 10 protects mice from lethal endotoxemia. J. Exp. Med., 177: 1205-1208.

Reference

  1. Denizot, F., & Lang, R. (1986). Rapid colorimetric assay for cell growth and survival: modifications to the tetrazolium dye procedure giving improved sensitivity and reliability. Journal of immunological methods, 89(2), 271-277.
  2. Farkhondeh, T.; Samarghandian, S.; Azimin-Nezhad, M.; Samini, F. Effect of chrysin on nociception in formalin test and serum levels of noradrenalin and corticosterone in rats. Int. J. Clin. Exp. Med., 2015, 8(2), 2465-2470.
  3. Bengmark S. Curcumin, an atoxic antioxidant and natural NFkappaB, cyclooxygenase-2, lipooxygenase, and inducible nitric oxide synthase inhibitor: A shield against acute and chronic diseases. J. Parenter. Enteral. Nutr. 2006;30:45–51.
  4. Lee, S. B., Lee, W. S., Shin, J. S., Jang, D. S., & Lee, K. T. (2017). Xanthotoxin suppresses LPS-induced expression of iNOS, COX-2, TNF-α, and IL-6 via AP-1, NF-κB, and JAK-STAT inactivation in RAW 264.7 macrophages. International immunopharmacology, 49, 21-29.
  5. Hossen, M., Yang, W., Kim, D. et al. Thymoquinone: An IRAK1 inhibitor with in vivo and in vitro anti-inflammatory activities. Sci Rep 7, 42995 (2017).
  6. Meng, Z., Yan, C., Deng, Q., Gao, D. F., & Niu, X. L. (2013). Curcumin inhibits LPS-induced inflammation in rat vascular smooth muscle cells in vitro via ROS-relative TLR4-MAPK/NF-κB pathways. Acta Pharmacologica Sinica, 34(7), 901-911.
  7. Setyono, J., Harini, I. M., Sarmoko, S., & Rujito, L. (2019). Supplementation of curcuma domestica extract reduces cox-2 and iNOS expression on raw 264.7 cells. In Journal of Physics: Conference Series (Vol. 1246, No. 1, p. 012059). IOP Publishing.
  8. Shaterzadeh-Yazdi, H., Noorbakhsh, M. F., Hayati, F., Samarghandian, S., & Farkhondeh, T. (2018). Immunomodulatory and anti-inflammatory effects of thymoquinone. Cardiovascular & Haematological Disorders-Drug Targets (Formerly Current Drug Targets-Cardiovascular & Hematological Disorders), 18(1), 52-60.
  9. Turner, M.D.; Nedjai, B.; Hurst, T.; Pennington, D.J. Cytokines and chemokines: At the crossroads of cell signaling and inflammatory disease. Biochim. Biophys. Acta., 2014, 30, 1843(11), 2563-2582.
  10. Wang, D., Qiao, J., Zhao, X., Chen, T., & Guan, D. (2015). Thymoquinone inhibits IL-1β-induced inflammation in human osteoarthritis chondrocytes by suppressing NF-κB and MAPKs signaling pathway. Inflammation, 38, 2235-2241.
  11. Yard?mc?, M., Goz, M., Ayd?n, M. S., Kank?l?ç, N., & Temiz, E. (2022). Antioxidant actions of thymoquinone, silymarin, and curcumin on experimental aortic ischemia-reperfusion model in wistar albino rats. Brazilian Journal of Cardiovascular Surgery, 37(06), 807-813.
  12. Zhang, Y., Liang, D., Dong, L., Ge, X., Xu, F., Chen, W., ... & Liang, G. (2015). Anti-inflammatory effects of novel curcumin analogs in experimental acute lung injury. Respiratory research, 16, 1-13.
  13. Peng Y, Ao M, Dong B, Jiang Y, Yu L, Chen Z, Hu C, Xu R. Anti-Inflammatory Effects of Curcumin in the Inflammatory Diseases: Status, Limitations and Countermeasures. Drug Des Devel Ther. 2021 Nov 2;15:4503-25.
  14. Mehkri S., Chandrasagar K., Ashok G., Bopanna K. "Evaluation of in vitro immuno modulatory activity of thymopure™ Nigella sativa oil in dendritic cells ". International Journal of Biology Research, Volume 6, Issue 2, 2021a, Pages 53-57
  15. Mehkri S., Chandrasagar K., Ashok G., Bopanna K. "Evaluation of in vitro phagocytic property of macrophages in presence of thymopure™ (Nigella Sativa) oil " . International Journal of Biology Research, Volume 6, Issue 2, 2021b, Pages 18-21
  16. Mehkri S., Chandrasagar K., Ashok G., Bopanna K. "Evaluation of thymopureTM (Nigella sativa) oil on the in vitro expression levels of selected cytokines in mouse macrophages cells" . International Journal of Biology Research, Volume 6, Issue 4, 2021c, Pages 5-10
  17. M.M. Soliman, Y.A. El-Fattah El-Senosi, O.M.A. El-Hamid, A.El-Desouki Abd El-Mageed, R.S. Ismaeil and H.A. El-Maqsoud Ali, 2009. Nigella sativa Modulates Cytokines Expression in Mature Bovine Adipocytes. Asian Journal of Biochemistry, 4: 60-67.
  18. Ibrahim, S., M. Ishizuka, M. Soliman, K. El-Bohi and K. Sobhy et al., 2008. Protection by Nigella sativa against carbon tetrachloride induced downregulation of hepatic cytochrome P450 isozymes in rats. Japanese J. Vet. Res., 56: 119-128.
  19. Salem, M.L., 2005. Immunomodulatory and therapeutic properties of the Nigella sativa L. seed. Int. Immunopharmacol., 5: 1749-1770.
  20. Howard, M., T. Muchamuel, S. Andrade and S. Menon, 1993. Interleukin 10 protects mice from lethal endotoxemia. J. Exp. Med., 177: 1205-1208.

Photo
Dr. Krathish Bopanna
Corresponding author

Consultant Pharmacologist, Bangalore, India.

Photo
S. Mehkri
Co-author

Bio-gen Extracts Pvt. Ltd., Bangalore, India.

Photo
K. G. Dinesh
Co-author

R&D Head, Radiant Research Bangalore, India.

Photo
Dr. G. Ashok
Co-author

Director, Radiant Research, Bangalore, India.

S. Mehkri, K. G. Dinesh, Dr. G. Ashok, Dr. Krathish Bopanna*, Anti-inflammatory Effects of a Curcumin-Thymoquinone Complex (CurQnone®) and Curcumin Alone in LPS-Stimulated RAW 264.7 Cells: A Comparative Study, Int. J. of Pharm. Sci., 2025, Vol 3, Issue 6, 4128-4137. https://doi.org/10.5281/zenodo.15735101

More related articles
A Brief Review on Wedelia Chinensis (Osbeck) Merr...
Sharmili D, Mohamed Hussain N, Pachiyammal M, Tamilarasan R, B Ku...
Long-Term Melatonin Use: Benefits, Risks, And Clin...
Swaraj Mahanag, Dr. Anand Khode, Gauri Kshirsagar...
Related Articles
Formulation and Evaluation of a Sesame Oil-Based Foot Crack Cream for Wound Heal...
Sandhya khyamgonde , Avinash Hosmani, Laxmi Kawade, Sakshi Bhanap, Y.S. Thorat...
Application of natural modified starch as excipient for tailored pharmaceutical ...
Deepak Babu, Diksha Devi, Nita Yadav, Gaurav Kumar Chaurasia, Ritesh Kumar Tiwari...
A Brief Review on Wedelia Chinensis (Osbeck) Merr...
Sharmili D, Mohamed Hussain N, Pachiyammal M, Tamilarasan R, B Kumudhaveni, Vijaya Bharathi R, Muthu...
More related articles
A Brief Review on Wedelia Chinensis (Osbeck) Merr...
Sharmili D, Mohamed Hussain N, Pachiyammal M, Tamilarasan R, B Kumudhaveni, Vijaya Bharathi R, Muthu...
Long-Term Melatonin Use: Benefits, Risks, And Clinical Implications...
Swaraj Mahanag, Dr. Anand Khode, Gauri Kshirsagar...
A Brief Review on Wedelia Chinensis (Osbeck) Merr...
Sharmili D, Mohamed Hussain N, Pachiyammal M, Tamilarasan R, B Kumudhaveni, Vijaya Bharathi R, Muthu...
Long-Term Melatonin Use: Benefits, Risks, And Clinical Implications...
Swaraj Mahanag, Dr. Anand Khode, Gauri Kshirsagar...